Metadata-Version: 2.1
Name: seqfold
Version: 0.7.7
Summary: Predict the minimum free energy structure of nucleic acids
Home-page: https://github.com/Lattice-Automation/seqfold
Author: JJTimmons
Author-email: jtimmons@latticeautomation.com
License: mit
Description: # seqfold
        
        [![DOI](https://zenodo.org/badge/224018980.svg)](https://zenodo.org/badge/latestdoi/224018980)
        
        Predict the minimum free energy structure of nucleic acids.
        
        `seqfold` is an implementation of the `Zuker, 1981` dynamic programming algorithm, the basis for [UNAFold](http://unafold.rna.albany.edu/?q=DINAMelt/software)/[mfold](https://www.ibridgenetwork.org/#!/profiles/1045554571442/innovations/1/), with energy functions from `SantaLucia, 2004` (DNA) and `Turner, 2009` (RNA).
        
        ## Installation
        
        ```bash
        pip install seqfold
        ```
        
        ## Usage
        
        ### Python
        
        ```python
        from seqfold import dg, dg_cache, fold
        
        # just returns minimum free energy
        dg("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC", temp = 37.0)  # -12.94
        
        # `fold` returns a list of `seqfold.Struct` from the minimum free energy structure
        structs = fold("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC")
        print(sum(s.e for s in structs))  # -12.94, same as dg()
        for struct in structs:
            print(struct) # prints the i, j, ddg, and description of each structure
        
        # `dg_cache` returns a 2D array where each (i,j) combination returns the MFE from i to j inclusive
        cache = dg_cache("GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC")
        ```
        
        ### CLI
        
        ```txt
        usage: seqfold [-h] [-t FLOAT] [-v] [-l] [--version] SEQ
        
        Predict the minimum free energy (kcal/mol) of a nucleic acid sequence
        
        positional arguments:
          SEQ            nucleic acid sequence to fold
        
        optional arguments:
          -h, --help     show this help message and exit
          -t FLOAT       temperature in Celsius
          -v, --verbose  log a dot-bracket of the MFE structure
          -l, --log      log each substructure in the MFE folding
          --version      show program's version number and exit
        ```
        
        #### Examples
        
        ```bash
        $ seqfold GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC -t 32
        -17.1
        ```
        
        ```bash
        $ seqfold GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC -t 32 -v -l
        GGGAGGTCGTTACATCTGGGTAACACCGGTACTGATCCGGTGACCTCCC
        ((((((((.((((......))))..((((.......)))).))))))))
           i    j    ddg  description
           0   48   -2.2  STACK:GG/CC
           1   47   -2.2  STACK:GG/CC
           2   46   -1.4  STACK:GA/CT
           3   45   -1.4  STACK:AG/TC
           4   44   -2.2  STACK:GG/CC
           5   43   -1.6  STACK:GT/CA
           6   42   -1.4  STACK:TC/AG
           7   41   -0.5  BIFURCATION:4n/3h
           9   22   -1.1  STACK:TT/AA
          10   21   -1.0  STACK:TA/AT
          11   20   -1.6  STACK:AC/TG
          12   19    3.0  HAIRPIN:CA/GG
          25   39   -2.2  STACK:CC/GG
          26   38   -2.3  STACK:CG/GC
          27   37   -2.2  STACK:GG/CC
          28   36    3.2  HAIRPIN:GT/CT
        -17.1
        ```
        
        ### Notes
        
        - The type of nucleic acid, DNA or RNA, is inferred from the input sequence.
        - `seqfold` is case-insensitive with the input sequence.
        - The default temperature is 37 degrees Celsius for both the Python and CLI interface.
        
        ## Motivation
        
        Secondary structure prediction is used for making [PCR primers](https://academic.oup.com/nar/article/40/15/e115/1223759), designing [oligos for MAGE](https://pubs.acs.org/doi/abs/10.1021/acssynbio.5b00219), and tuning [RBS expression rates](https://www.sciencedirect.com/science/article/pii/B9780123851208000024).
        
        While [UNAFold](http://unafold.rna.albany.edu/?q=DINAMelt/software) and [mfold](https://www.ibridgenetwork.org/#!/profiles/1045554571442/innovations/1/) are the most widely used applications for nucleic acid secondary structure prediction, their format and license are restrictive. `seqfold` is meant to be an open-source, minimalist alternative for predicting minimum free energy secondary structure.
        
        |              | seqfold               | mfold                                                                                  | UNAFold                                                                                          |
        | ------------ | --------------------- | -------------------------------------------------------------------------------------- | ------------------------------------------------------------------------------------------------ |
        | License      | MIT                   | [Academic Non-commercial](http://unafold.rna.albany.edu/download/Academic_License.txt) | [\$200-36,000](https://www.ibridgenetwork.org/#!/profiles/1045554571442/innovations/1/products/) |
        | OS           | Linux, MacOS, Windows | Linux, MacOS                                                                           | Linux, MacOS, Windows                                                                            |
        | Format       | python, CLI python    | CLI binary                                                                             | CLI binary                                                                                       |
        | Dependencies | none                  | (mfold_util)                                                                           | Perl, (gnuplot, glut/OpenGL)                                                                     |
        | Graphical    | no                    | yes (output)                                                                           | yes (output)                                                                                     |
        | Heterodimers | no                    | yes                                                                                    | yes                                                                                              |
        | Constraints  | no                    | yes                                                                                    | yes                                                                                              |
        
        ## Citations
        
        Papers, and how they helped in developing `seqfold`, are listed below.
        
        ### Nussinov, 1980
        
        > Nussinov, Ruth, and Ann B. Jacobson. "Fast algorithm for predicting the secondary structure of single-stranded RNA." Proceedings of the National Academy of Sciences 77.11 (1980): 6309-6313.
        
        Framework for the dynamic programming approach. It has a conceptually helpful "Maximal Matching" example that demonstrates the approach on a simple sequence with only matched or unmatched bp.
        
        ### Zuker, 1981
        
        > Zuker, Michael, and Patrick Stiegler. "Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information." Nucleic acids research 9.1 (1981): 133-148.
        
        The most cited paper in this space. Extends further than `Nussinov, 1980` with a nearest neighbor approach to energies and a consideration of each of stack, bulge, internal loop, and hairpin. Their data structure and traceback method are both more intuitive than `Nussinov, 1980`.
        
        ### Jaeger, 1989
        
        > Jaeger, John A., Douglas H. Turner, and Michael Zuker. "Improved predictions of secondary structures for RNA." Proceedings of the National Academy of Sciences 86.20 (1989): 7706-7710.
        
        Zuker and colleagues expand on the 1981 paper to incorporate penalties for multibranched loops and dangling ends.
        
        ### SantaLucia, 2004
        
        > SantaLucia Jr, John, and Donald Hicks. "The thermodynamics of DNA structural motifs." Annu. Rev. Biophys. Biomol. Struct. 33 (2004): 415-440.
        
        The paper from which almost every DNA energy function in `seqfold` comes from (with the exception of multibranch loops). Provides neighbor entropies and enthalpies for stacks, mismatching stacks, terminal stacks, and dangling stacks. Ditto for bulges, internal loops, and hairpins.
        
        ### Turner, 2009
        
        > Turner, Douglas H., and David H. Mathews. "NNDB: the nearest neighbor parameter database for predicting stability of nucleic acid secondary structure." Nucleic acids research 38.suppl_1 (2009): D280-D282.
        
        Source of RNA nearest neighbor change in entropy and enthalpy parameter data. In `/data`.
        
        ### Ward, 2017
        
        > Ward, M., Datta, A., Wise, M., & Mathews, D. H. (2017). Advanced multi-loop algorithms for RNA secondary structure prediction reveal that the simplest model is best. Nucleic acids research, 45(14), 8541-8550.
        
        An investigation of energy functions for multibranch loops that validates the simple linear approach employed by `Jaeger, 1989` that keeps runtime within `O(n³)`.
        
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Programming Language :: Python :: 3 :: Only
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Environment :: Console
Requires-Python: >=3.5
Description-Content-Type: text/markdown
Provides-Extra: dev
