Metadata-Version: 1.1
Name: pyfaidx
Version: 0.5.0
Summary: pyfaidx: efficient pythonic random access to fasta subsequences
Home-page: http://mattshirley.com
Author: Matthew Shirley
Author-email: mdshw5@gmail.com
License: BSD
Description: |Travis| |PyPI| |Landscape| |Coverage| |Depsy| |Appveyor|
        
        Description
        -----------
        
        Samtools provides a function "faidx" (FAsta InDeX), which creates a
        small flat index file ".fai" allowing for fast random access to any
        subsequence in the indexed FASTA file, while loading a minimal amount of the
        file in to memory. This python module implements pure Python classes for
        indexing, retrieval, and in-place modification of FASTA files using a samtools
        compatible index. The pyfaidx module is API compatible with the `pygr`_ seqdb module.
        A command-line script "`faidx`_" is installed alongside the pyfaidx module, and
        facilitates complex manipulation of FASTA files without any programming knowledge.
        
        .. _`pygr`: https://github.com/cjlee112/pygr
        
        If you use pyfaidx in your publication, please cite:
        
        `Shirley MD`_, `Ma Z`_, `Pedersen B`_, `Wheelan S`_. `Efficient "pythonic" access to FASTA files using pyfaidx <https://dx.doi.org/10.7287/peerj.preprints.970v1>`_. PeerJ PrePrints 3:e1196. 2015.
        
        .. _`Shirley MD`: http://github.com/mdshw5
        .. _`Ma Z`: http://github.com/azalea
        .. _`Pedersen B`: http://github.com/brentp
        .. _`Wheelan S`: http://github.com/swheelan
        
        Installation
        ------------
        
        This package is tested under Linux, MacOS, and Windows using Python 3.2-3.4, 2.7, 2.6, and pypy and is available from the PyPI:
        
        ::
        
            pip install pyfaidx  # add --user if you don't have root
        
        or download a `release <https://github.com/mdshw5/pyfaidx/releases>`_ and:
        
        ::
        
            python setup.py install
        
        If using ``pip install --user`` make sure to add ``/home/$(whoami)/.local/bin`` to your ``$PATH`` if you want to run the ``faidx`` script.
        
        Usage
        -----
        
        .. code:: python
        
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta')
            >>> genes
            Fasta("tests/data/genes.fasta")  # set strict_bounds=True for bounds checking
        
        Acts like a dictionary.
        
        .. code:: python
        
            >>> genes.keys() ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')
        
            >>> genes['NM_001282543.1'][200:230]
            >NM_001282543.1:201-230
            CTCGTTCCGCGCCCGCCATGGAACCGGATG
        
            >>> genes['NM_001282543.1'][200:230].seq
            'CTCGTTCCGCGCCCGCCATGGAACCGGATG'
        
            >>> genes['NM_001282543.1'][200:230].name
            'NM_001282543.1'
        
            # Start attributes are 1-based
            >>> genes['NM_001282543.1'][200:230].start
            201
        
            # End attributes are 0-based
            >>> genes['NM_001282543.1'][200:230].end
            230
        
            >>> genes['NM_001282543.1'][200:230].fancy_name
            'NM_001282543.1:201-230'
        
            >>> len(genes['NM_001282543.1'])
            5466
        
        Note that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``. This argument only affects the ``Sequence .start/.end`` attributes, and has no effect on slicing coordinates.
        
        Indexes like a list:
        
        .. code:: python
        
            >>> genes[0][:50]
            >AB821309.1:1-50
            ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC
        
        Slices just like a string:
        
        .. code:: python
        
            >>> genes['NM_001282543.1'][200:230][:10]
            >NM_001282543.1:201-210
            CTCGTTCCGC
        
            >>> genes['NM_001282543.1'][200:230][::-1]
            >NM_001282543.1:230-201
            GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
        
            >>> genes['NM_001282543.1'][200:230][::3]
            >NM_001282543.1:201-230
            CGCCCCTACA
        
            >>> genes['NM_001282543.1'][:]
            >NM_001282543.1:1-5466
            CCCCGCCCCT........
        
        - Slicing start and end coordinates are 0-based, just like Python sequences.
        
        Sequence can be buffered in memory using a read-ahead buffer
        for fast sequential access:
        
        .. code:: python
        
            >>> from timeit import timeit
            >>> fetch = "genes['NM_001282543.1'][200:230]"
            >>> read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta', read_ahead=10000)"
            >>> no_read_ahead = "import pyfaidx; genes = pyfaidx.Fasta('tests/data/genes.fasta')"
            >>> string_slicing = "genes = {}; genes['NM_001282543.1'] = 'N'*10000"
        
            >>> timeit(fetch, no_read_ahead, number=10000)
            0.2204863309962093
            >>> timeit(fetch, read_ahead, number=10000)
            0.1121859749982832
            >>> timeit(fetch, string_slicing, number=10000)
            0.0033553699977346696
        
        Read-ahead buffering can reduce runtime by 1/2 for sequential accesses to buffered regions.
        
        Complements and reverse complements just like DNA
        
        .. code:: python
        
            >>> genes['NM_001282543.1'][200:230].complement
            >NM_001282543.1 (complement):201-230
            GAGCAAGGCGCGGGCGGTACCTTGGCCTAC
        
            >>> genes['NM_001282543.1'][200:230].reverse
            >NM_001282543.1:230-201
            GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
        
            >>> -genes['NM_001282543.1'][200:230]
            >NM_001282543.1 (complement):230-201
            CATCCGGTTCCATGGCGGGCGCGGAACGAG
        
        .. _keyfn:
        
        Custom key functions provide cleaner access:
        
        .. code:: python
        
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
            >>> genes.keys()
            dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
            >>> genes['NR_104212'][:10]
            >NR_104212:1-10
            CCCCGCCCCT
        
        You can specify a character to split names on, which will generate additional entries:
        
        .. code:: python
        
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta', split_char='.', duplicate_action="first") # default duplicate_action="stop"
            >>> genes.keys()
            dict_keys(['.1', 'NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
        
        If your `key_function` or `split_char` generates duplicate entries, you can choose what action to take:
        
        .. code:: python
        
            # new in v0.4.9
            >>> genes = Fasta('tests/data/genes.fasta', split_char="|", duplicate_action="longest")
            >>> genes.keys()
            dict_keys(['gi', '563317589', 'dbj', 'AB821309.1', '', '557361099', 'gb', 'KF435150.1', '557361097', 'KF435149.1', '543583796', 'ref', 'NR_104216.1', '543583795', 'NR_104215.1', '543583794', 'NR_104212.1', '543583788', 'NM_001282545.1', '543583786', 'NM_001282543.1', '543583785', 'NM_000465.3', '543583740', 'NM_001282549.1', '543583738', 'NM_001282548.1', '530384540', 'XM_005249645.1', '530384538', 'XM_005249644.1', '530384536', 'XM_005249643.1', '530384534', 'XM_005249642.1', '530373237','XM_005265508.1', '530373235', 'XM_005265507.1', '530364726', 'XR_241081.1', '530364725', 'XR_241080.1', '530364724', 'XR_241079.1'])
        
        Filter functions (returning True) limit the index:
        
        .. code:: python
        
            # new in v0.3.8
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta', filt_function = lambda x: x[0] == 'N')
            >>> genes.keys()
            dict_keys(['NR_104212', 'NM_001282543', 'NR_104216', 'NR_104215', 'NM_001282549', 'NM_000465', 'NM_001282545', 'NM_001282548'])
            >>> genes['XM_005249644']
            KeyError: XM_005249644 not in tests/data/genes.fasta.
        
        Or just get a Python string:
        
        .. code:: python
        
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
            >>> genes
            Fasta("tests/data/genes.fasta", as_raw=True)
        
            >>> genes['NM_001282543.1'][200:230]
            CTCGTTCCGCGCCCGCCATGGAACCGGATG
        
        You can make sure that you always receive an uppercase sequence, even if your fasta file has lower case
        
        .. code:: python
        
            >>> from pyfaidx import Fasta
            >>> reference = Fasta('tests/data/genes.fasta.lower', sequence_always_upper=True)
            >>> reference['gi|557361099|gb|KF435150.1|'][1:70]
        
            >gi|557361099|gb|KF435150.1|:2-70
            TGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA
        
        
        You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:
        
        .. code:: python
        
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta')
            >>> for line in genes['NM_001282543.1']:
            ...   print(line)
            CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
            AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
            CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
            ...
        
        Sequence names are truncated on any whitespace. This is a limitation of the indexing strategy. However, full names can be recovered:
        
        .. code:: python
        
            # new in v0.3.7
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta')
            >>> for record in genes:
            ...   print(record.name)
            ...   print(record.long_name)
            ...
            gi|563317589|dbj|AB821309.1|
            gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
            gi|557361099|gb|KF435150.1|
            gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
            gi|557361097|gb|KF435149.1|
            gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds
            ...
        
            # new in v0.4.9
            >>> from pyfaidx import Fasta
            >>> genes = Fasta('tests/data/genes.fasta', read_long_names=True)
            >>> for record in genes:
            ...   print(record.name)
            ...
            gi|563317589|dbj|AB821309.1| Homo sapiens FGFR2-AHCYL1 mRNA for FGFR2-AHCYL1 fusion kinase protein, complete cds
            gi|557361099|gb|KF435150.1| Homo sapiens MDM4 protein variant Y (MDM4) mRNA, complete cds, alternatively spliced
            gi|557361097|gb|KF435149.1| Homo sapiens MDM4 protein variant G (MDM4) mRNA, complete cds
        
        .. role:: red
        
        If you want to modify the contents of your FASTA file in-place, you can use the `mutable` argument.
        Any portion of the FastaRecord can be replaced with an equivalent-length string.
        :red:`Warning`: *This will change the contents of your file immediately and permanently:*
        
        .. code:: python
        
            >>> genes = Fasta('tests/data/genes.fasta', mutable=True)
            >>> type(genes['NM_001282543.1'])
            <class 'pyfaidx.MutableFastaRecord'>
        
            >>> genes['NM_001282543.1'][:10]
            >NM_001282543.1:1-10
            CCCCGCCCCT
            >>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
            >>> genes['NM_001282543.1'][:15]
            >NM_001282543.1:1-15
            NNNNNNNNNNCTGGC
        
        The FastaVariant class provides a way to integrate single nucleotide variant calls to generate a consensus sequence.
        
        .. code:: python
        
            # new in v0.4.0
            >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', het=True, hom=True)
            RuntimeWarning: Using sample NA06984 genotypes.
        
            >>> consensus['22'].variant_sites
            (16042793, 21833121, 29153196, 29187373, 29187448, 29194610, 29821295, 29821332, 29993842, 32330460, 32352284)
        
            >>> consensus['22'][16042790:16042800]
            >22:16042791-16042800
            TCGTAGGACA
        
            >>> Fasta('tests/data/chr22.fasta')['22'][16042790:16042800]
            >22:16042791-16042800
            TCATAGGACA
        
            >>> consensus = FastaVariant('tests/data/chr22.fasta', 'tests/data/chr22.vcf.gz', sample='NA06984', het=True, hom=True, call_filter='GT == "0/1"')
            >>> consensus['22'].variant_sites
            (16042793, 29187373, 29187448, 29194610, 29821332)
        
        .. _faidx:
        
        It also provides a command-line script:
        
        cli script: faidx
        ~~~~~~~~~~~~~~~~~
        
        .. code:: bash
        
            Fetch sequences from FASTA. If no regions are specified, all entries in the
            input file are returned. Input FASTA file must be consistently line-wrapped,
            and line wrapping of output is based on input line lengths.
        
            positional arguments:
              fasta                 FASTA file
              regions               space separated regions of sequence to fetch e.g.
                                    chr1:1-1000
        
            optional arguments:
              -h, --help            show this help message and exit
              -b BED, --bed BED     bed file of regions
              -o OUT, --out OUT     output file name (default: stdout)
              -i {bed,chromsizes,nucleotide,transposed}, --transform {bed,chromsizes,nucleotide,transposed} transform the requested regions into another format. default: None
              -c, --complement      complement the sequence. default: False
              -r, --reverse         reverse the sequence. default: False
              -a SIZE_RANGE, --size-range SIZE_RANGE
                                    selected sequences are in the size range [low, high]. example: 1,1000 default: None
              -n, --no-names        omit sequence names from output. default: False
              -f, --full-names      output full names including description. default: False
              -x, --split-files     write each region to a separate file (names are derived from regions)
              -l, --lazy            fill in --default-seq for missing ranges. default: False
              -s DEFAULT_SEQ, --default-seq DEFAULT_SEQ
                                    default base for missing positions and masking. default: N
              -d DELIMITER, --delimiter DELIMITER
                                    delimiter for splitting names to multiple values (duplicate names will be discarded). default: None
              -e HEADER_FUNCTION, --header-function HEADER_FUNCTION
                                    python function to modify header lines e.g: "lambda x: x.split("|")[0]". default: lambda x: x.split()[0]
              -u {stop,first,last,longest,shortest}, --duplicates-action {stop,first,last,longest,shortest}
                                    entry to take when duplicate sequence names are encountered. default: stop
              -g REGEX, --regex REGEX
                                    selected sequences are those matching regular expression. default: .*
              -v, --invert-match    selected sequences are those not matching 'regions' argument. default: False
              -m, --mask-with-default-seq
                                    mask the FASTA file using --default-seq default: False
              -M, --mask-by-case    mask the FASTA file by changing to lowercase. default: False
              -e HEADER_FUNCTION, --header-function HEADER_FUNCTION
                                    python function to modify header lines e.g: "lambda x: x.split("|")[0]". default: None
              --no-rebuild          do not rebuild the .fai index even if it is out of date. default: False
              --version             print pyfaidx version number
        
        Examples:
        
        .. code:: bash
        
            $ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
            >NM_001282543.1:201-210
            CTCGTTCCGC
            >NM_001282543.1:300-320
            GTAATTGTGTAAGTGACTGCA
        
            $ faidx --full-names tests/data/genes.fasta NM_001282543.1:201-210
            >NM_001282543.1| Homo sapiens BRCA1 associated RING domain 1 (BARD1), transcript variant 2, mRNA
            CTCGTTCCGC
        
            $ faidx --no-names tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
            CTCGTTCCGC
            GTAATTGTGTAAGTGACTGCA
        
            $ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
            >NM_001282543.1:201-210 (complement)
            GAGCAAGGCG
        
            $ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
            >NM_001282543.1:210-201
            CGCCTTGCTC
        
            $ faidx --reverse --complement tests/data/genes.fasta NM_001282543.1:201-210
            >NM_001282543.1:210-201 (complement)
            GCGGAACGAG
        
            $ faidx tests/data/genes.fasta NM_001282543.1
            >NM_001282543.1:1-5466
            CCCCGCCCCT........
            ..................
            ..................
            ..................
        
            $ faidx --regex "^NM_00128254[35]" genes.fasta
            >NM_001282543.1
            ..................
            ..................
            ..................
            >NM_001282545.1
            ..................
            ..................
            ..................
        
            $ faidx --lazy tests/data/genes.fasta NM_001282543.1:5460-5480
            >NM_001282543.1:5460-5480
            AAAAAAANNNNNNNNNNNNNN
        
            $ faidx --lazy --default-seq='Q' tests/data/genes.fasta NM_001282543.1:5460-5480
            >NM_001282543.1:5460-5480
            AAAAAAAQQQQQQQQQQQQQQ
        
            $ faidx tests/data/genes.fasta --bed regions.bed
            ...
        
            $ faidx --transform chromsizes tests/data/genes.fasta
            AB821309.1	3510
            KF435150.1	481
            KF435149.1	642
            NR_104216.1	4573
            NR_104215.1	5317
            NR_104212.1	5374
            ...
        
            $ faidx --transform bed tests/data/genes.fasta
            AB821309.1	1    3510
            KF435150.1	1    481
            KF435149.1	1    642
            NR_104216.1	1   4573
            NR_104215.1	1   5317
            NR_104212.1	1   5374
            ...
        
            $ faidx --transform nucleotide tests/data/genes.fasta
            name	start	end	A	T	C	G	N
            AB821309.1	1	3510	955	774	837	944	0
            KF435150.1	1	481	149	120	103	109	0
            KF435149.1	1	642	201	163	129	149	0
            NR_104216.1	1	4573	1294	1552	828	899	0
            NR_104215.1	1	5317	1567	1738	968	1044	0
            NR_104212.1	1	5374	1581	1756	977	1060	0
            ...
        
            faidx --transform transposed tests/data/genes.fasta
            AB821309.1	1	3510	ATGGTCAGCTGGGGTCGTTTCATC...
            KF435150.1	1	481	ATGACATCATTTTCCACCTCTGCT...
            KF435149.1	1	642	ATGACATCATTTTCCACCTCTGCT...
            NR_104216.1	1	4573	CCCCGCCCCTCTGGCGGCCCGCCG...
            NR_104215.1	1	5317	CCCCGCCCCTCTGGCGGCCCGCCG...
            NR_104212.1	1	5374	CCCCGCCCCTCTGGCGGCCCGCCG...
            ...
        
            $ faidx --split-files tests/data/genes.fasta
            $ ls
            AB821309.1.fasta	NM_001282549.1.fasta	XM_005249645.1.fasta
            KF435149.1.fasta	NR_104212.1.fasta	XM_005265507.1.fasta
            KF435150.1.fasta	NR_104215.1.fasta	XM_005265508.1.fasta
            NM_000465.3.fasta	NR_104216.1.fasta	XR_241079.1.fasta
            NM_001282543.1.fasta	XM_005249642.1.fasta	XR_241080.1.fasta
            NM_001282545.1.fasta	XM_005249643.1.fasta	XR_241081.1.fasta
            NM_001282548.1.fasta	XM_005249644.1.fasta
        
            $ faidx --delimiter='_' tests/data/genes.fasta 000465.3
            >000465.3
            CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
            AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
            .......
        
            $ faidx --size-range 5500,6000 -i chromsizes tests/data/genes.fasta
            NM_000465.3	5523
        
            $ faidx -m --bed regions.bed tests/data/genes.fasta
            ### Modifies tests/data/genes.fasta by masking regions using --default-seq character ###
        
            $ faidx -M --bed regions.bed tests/data/genes.fasta
            ### Modifies tests/data/genes.fasta by masking regions using lowercase characters ###
        
            $ faidx -e "lambda x: x.split('.')[0]" tests/data/genes.fasta -i bed
            AB821309	1	3510
            KF435150	1	481
            KF435149	1	642
            NR_104216	1	4573
            NR_104215	1	5317
            .......
        
        
        Similar syntax as ``samtools faidx``
        
        
        A lower-level Faidx class is also available:
        
        .. code:: python
        
            >>> from pyfaidx import Faidx
            >>> fa = Faidx('genes.fa')  # can return str with as_raw=True
            >>> fa.index
            OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])
        
            >>> fa.index['AB821309.1'].rlen
            3510
        
            fa.fetch('AB821309.1', 1, 10)  # these are 1-based genomic coordinates
            >AB821309.1:1-10
            ATGGTCAGCT
        
        
        -  If the FASTA file is not indexed, when ``Faidx`` is initialized the
           ``build_index`` method will automatically run, and
           the index will be written to "filename.fa.fai" with ``write_fai()``.
           where "filename.fa" is the original FASTA file.
        -  Start and end coordinates are 1-based.
        
        Support for compressed FASTA
        ----------------------------
        
        ``pyfaidx`` can create and read ``.fai`` indices for FASTA files that have
        been compressed using the `bgzip <http://www.htslib.org/doc/tabix.html>`_
        tool from `samtools <http://www.htslib.org/>`_. ``bgzip`` writes compressed
        data in a ``BGZF`` format. ``BGZF`` is ``gzip`` compatible, consisting of
        multiple concatenated ``gzip`` blocks, each with an additional ``gzip``
        header making it possible to build an index for rapid random access. I.e.,
        files compressed with ``bgzip`` are valid ``gzip`` and so can be read by
        ``gunzip``.  See `this description
        <http://pydoc.net/Python/biopython/1.66/Bio.bgzf/>`_ for more details on
        ``bgzip``.
        
        Changelog
        ---------
        
        Please see the `releases <https://github.com/mdshw5/pyfaidx/releases>`_ for a
        comprehensive list of version changes.
        
        Known issues
        ------------
        
        I try to fix as many bugs as possible, but most of this work is supported by a single developer. Please check the `known issues <https://github.com/mdshw5/pyfaidx/issues?utf8=✓&q=is%3Aissue+is%3Aopen+label%3Aknown>`_ for bugs relevant to your work. Pull requests are welcome.
        
        
        Contributing
        ------------
        
        Create a new Pull Request with one feature. If you add a new feature, please
        create also the relevant test.
        
        To get test running on your machine:
         - Create a new virtualenv and install the `dev-requirements.txt`.
         - Download the test data running:
        
              python tests/data/download_gene_fasta.py
        
         - Run the tests with
        
              nosetests --with-coverage --cover-package=pyfaidx
        
        Acknowledgements
        ----------------
        
        This project is freely licensed by the author, `Matthew
        Shirley <http://mattshirley.com>`_, and was completed under the
        mentorship and financial support of Drs. `Sarah
        Wheelan <http://sjwheelan.som.jhmi.edu>`_ and `Vasan
        Yegnasubramanian <http://yegnalab.onc.jhmi.edu>`_ at the Sidney Kimmel
        Comprehensive Cancer Center in the Department of Oncology.
        
        .. |Travis| image:: https://travis-ci.org/mdshw5/pyfaidx.svg?branch=master
            :target: https://travis-ci.org/mdshw5/pyfaidx
        
        .. |PyPI| image:: https://img.shields.io/pypi/v/pyfaidx.svg?branch=master
            :target: https://pypi.python.org/pypi/pyfaidx
        
        .. |Landscape| image:: https://landscape.io/github/mdshw5/pyfaidx/master/landscape.svg
           :target: https://landscape.io/github/mdshw5/pyfaidx/master
           :alt: Code Health
        
        .. |Coverage| image:: https://codecov.io/gh/mdshw5/pyfaidx/branch/master/graph/badge.svg
           :target: https://codecov.io/gh/mdshw5/pyfaidx
        
        .. |Depsy| image:: http://depsy.org/api/package/pypi/pyfaidx/badge.svg
           :target: http://depsy.org/package/python/pyfaidx
        
        .. |Appveyor| image:: https://ci.appveyor.com/api/projects/status/80ihlw30a003596w?svg=true
           :target: https://ci.appveyor.com/project/mdshw5/pyfaidx
        
Platform: UNKNOWN
Classifier: Development Status :: 5 - Production/Stable
Classifier: License :: OSI Approved :: BSD License
Classifier: Environment :: Console
Classifier: Intended Audience :: Science/Research
Classifier: Natural Language :: English
Classifier: Operating System :: Unix
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.4
Classifier: Programming Language :: Python :: 3.3
Classifier: Programming Language :: Python :: 3.2
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 2.6
Classifier: Programming Language :: Python :: Implementation :: PyPy
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Provides: p
Provides: y
Provides: f
Provides: a
Provides: i
Provides: d
Provides: x
